Introduction
White spot syndrome virus (WSSV) remains the most feared pathogenic agent for the shrimp aquaculture disease since its emergence in 1992 (Escobedo-Bonilla
2011). To date, WSSV is present in most of the world's shrimp farming areas and
causes significant economic losses to the shrimp aquaculture industry. However, no effective
chemicals or drugs are currently reported for control of shrimp
viral diseases. Approaches commonly used to battle shrimp diseases include
vaccination, immunostimulation, and environmental management. The
severe impact of viral disease on cultured shrimp has resulted in a
critical demand for application of advanced biotechnology. The use of
genetic transfer technology is a new strategy to produce the resistant shrimp
(Lu and Sun 2005).
Transgenic
fish/shrimp development offers excellent experimental models for basic
scientific research, environmental toxicology and biotechnology applications
(Wakchaure et al. 2015). As a model target species, Yasawa et al. (2005) evaluated gene transfer methods for black tiger shrimp using green fluorescence protein (GFP)
and chloramphenicol acetyl transferase (CAT) as a marker gene. More recently,
growth-enhanced transgenic organisms have been the main research subject in many fish species through the introduction
of growth hormone gene constructs (Alzaid et al.
2018; McClelland et al. 2020).
However, transgenic
technology provides a great prospect in developing strains that have high
resistance to disease-causing pathogens. A potential effort that can be done in
increasing disease resistance is the production of transgenic aquatic animals
that contain antibacterial or antiviral genes. The discovery of cecropin
antibacterial protein in insects by Steiner et
al. (1981) was the beginning of antimicrobial research, which then
identified several other antimicrobials. Several antimicrobials have been
identified in mammals (Lehrer et al. 1993), amphibians (Bevins and
Zasloff 1990) and insects (Hoffmann et
al. 1996) where organisms containing the coding gene show better resistance
to disease.
Anderson et al. (1996) firstly proved by in vivo that the resistance of rainbow trout Oncorhynchus mykiss could be increased by transferring the coat protein of the virus. The introduction of cecropin construction increased the resistance to bacteria in channel catfish (Dunham et al. 2002) and in rainbow trout (Chiou et al. 2014). The related finding in transgenic medaka fish, which had higher resistance compared to non-transgenic fish against the bacteria Vibrio spp. and Pseudomonas spp. (Sarmasik et al. 2002). Meanwhile, recombinant DNA approaches, especially DNA vaccines have begun to be applied to aquaculture. Injecting Atlantic salmon with a glycolotein IHNV encoded plasmid with a pCMV promoter controller shows significant protection in the presence of virus neutralizing antibody formation after immunization and the titer increases after the challenge test (Traxler et al. 1999). As with other antimicrobials, the lysozyme gene has been reported to be one of the disease-resistant coding genes, especially non-specific antimicrobials (Austin and Allen-Austin 1985).
In
crustaceans, especially shrimp, increment of resistance at the molecular level
is still limited. The discovery of penaeidin encoding antimicrobial genes opens
opportunities in enhancing shrimp immunity against pathogenic infection.
Penaeidin application showed an effect to increase resistance in the white
shrimp Litopenaeus vannamei (Destoumieux
et al. 1997). The transfer of a new
antiviral gene was initiated in L.
vannamei through the introduction of TSV-CP (the coat
protein-encoding gene from TSV) (Sun et al. 2005). Lu and Sun (2005) reported that by introducing the
TSV-CP gene, transgenic shrimp showed significantly higher survival compared to
normal shrimp. Based on the results of these studies, the efforts to enhance
the resistance of tiger shrimp provide a positive confidence to be carried out.
Previous studies exhibited successfully isolated the promoter dan PmAV
antivirus gene from tiger shrimp (Parenrengi et al. 2009a, b) and introducing pProAV-EGFP gene construct “all
shrimp” into the tiger shrimp for promoter activity assessment (Parenrengi et al. 2018). This study aimed to assess the pattern of PmAV
gene expression in embryos/larvae and the performance of
transgenic tiger shrimp larvae through WSSV challenge test.
Materials and Methods Antivirus gene construction The construction of the pProAV-PmAV antiviral gene was created by ligating promoter antiviral (ProAV) (Parenrengi et al. 2009a) and PmAV gene (Parenrengi et al. 2009b) which were isolated from the tiger shrimp. Promoter ProAV was ligated at BamHI site and PmAV gene sequence was ligated at SalI site in pBlueskript-SK vector. Orientation test of ProAV-PmAV ligation was carried out using the PCR method with a set of primers: ProAV-F 5'- gtcggatccagtcccacactccatcaa -3' and PmAVSalI-R 5'- ttg tcgactcctttagaatatttattcttg -3'. The PCR reaction was 0.05 µL Taq Polymerase; 0.8 µL dNTP mix; 1 µL 10×buffer; 0.8 µL MgCl2; 1 µL DNA template; 10 ρmol each primer; and 4.35 µL sterile distilled water. The PCR was programed by pre-denaturation temperature of 94°C for 3 min, 30 cycles for (denaturation of 94°C for 30 s, annealing of 60°C for 30 s and extension of 72°C for 40 s), and a final extension of 72°C for 3 min. The PCR results were run on 1.0% agarose gel to determine the formed DNA fragments. Bacterial clones showing positive PCR results with fragments about 1.2 kb indicated the appropriate ligation direction.
Tiger shrimp maintenance
and embryo collection
Tiger shrimp brood stocks were maintained in a
hatchery facility of nucleus centre, Research Institute for Brackish water
Aquaculture and Fisheries Extension, South Sulawesi, Indonesia, and fed with
fresh squid Loligo spp. and sea-worm Nereis spp. of 15% per body
weight twice a day. Adult female (22.9–27.8 cm in total length and 125–237 g in
body weight) and male shrimps (18.5–22.3 cm in total length and 61–112 g in
body weight) were stocked to mating tanks, which were equipped with a constant water flow for 300% per day.
The mature gonadal females were then transferred for continuous monitoring to individual
spawning tanks. The
spawning usually occurred at night. The fertilized eggs (embryos) were immediately
collected approximately 5 min after spawning.
Antivirus
gene transfection
Bacteria carrying pProAV-PmAV
gene construct were cultured using LB media. The pProAV-PmAV plasmid was
isolated using GF-1 Plasmid DNA Extraction Kit by following the manual kit
procedure. Quantity and quality of plasmid isolates were measured at
wavelengths of 260 nm and 280 nm using a UV-VIS spectrophotometer. The plasmid
concentration was calculated by referring to the formula that has been
developed by Linacero et al. (1998); whereas
the plasmid purity was calculated from the absorption ratio of 260 nm and 280
nm (OD260/OD280).
The new spawning egg
collection and transfection procedures using the pProAV-PmAV plasmid refer to
the standard pProAV-EGFP gene transfection protocol developed by Parenrengi et al. (2018). In order
to determine a toxicity of transfection reagent, two control treatments were
applied to observe the hatching rate of tiger shrimp embryo. The positive
control (PC) was transfection procedure without using the plasmid of gene
construct, while the negative control (NC) was without plasmid and transfection
reagent. The three treatments had 5 replications (3 replicates for hatching
rate observation and 2 replications for sampling gene insertion and
expression). The
transfection of the pProAV-PmAV gene construct was carried out in two trial
groups, in which the egg concentrate was 370 eggs/2 mL in the first trial and
235 eggs /2 mL in the second trial. The transfected eggs were
rinsed with sterile seawater and stocked to the stopples filled with 2 L
seawater for incubation. The stopples were placed in water bath with heater to
maintain the stabilized temperature. The hatching rate of embryo was counted
after the incubation egg for 24 h. To determine the presence or absence of an
exogenous PmAV antiviral gene, genomic DNA and its expression of PmAV antiviral
genes by cDNA synthesis from RNA were performed in tiger shrimp larvae.
WSSV challenge test
Performance of transgenic
tiger shrimp was assessed through a larvae challenge test with WSSV, where
non-transgenic shrimp larvae were used as a control treatment. Both transgenic
and non-transgenic tiger shrimp larvae were maintained according to standard
larval rearing procedures until they reached to PL-25 stage. The WSSV was
isolated from naturally infected tiger shrimp by centrifugating the shrimp
liquid at 6,000 rpm for 15 min and filtering the supernatant with 0.45 µm in mesh size.
The culture tank was
disinfected with soaking 30 ppm chlorine for one day and then neutralized with
30 ppm sodium-thiosulfate. Each tank was filled with filtered seawater by a
filter membrane as much as 2 L and equipped with aeration system. Tiger shrimp
larvae PL-25 were stocked into a tank with a density of 15 shrimps. WSSV
inoculum was infected into shrimp larvae with a concentration of 2 mL L-1,
referring to the LC50 value that has been done in preliminary study.
The treatments of this
experiment were the WSSV challenge test on transgenic (A) and non-transgenic
tiger shrimp larvae (B), and non-transgenic shrimp larvae without challenge
test (C). Each treatment has 4 replications (3 for observation of survival
larvae and 1 for observation of antiviral gene expression). During the
experiment, the shrimp were fed with pellet larvae in ad-libitum 3 times a day. Observation of mortality for survival
rate and sampling of larval hepatopancreas for gene expression analysis was
performed at 6, 12, 24, 48, 72, 96, and 120 h post transfection (hpt).
Analysis of
PmAV gene expression
For analysis of transient
antiviral gene expression in embryos and tiger shrimp larvae, total RNA was
extracted using 50 embryos/larvae (pooled samples) and then followed by cDNA
synthesis. Analysis of gene expression was performed using RT-PCR technique in
several stages of observation, namely: 12, 18, 24, and 30 h post transfection
(hpt). Calculation of the hatching rate was done after the eggs incubated for
24 h. The PmAV antiviral gene and its expression were detected by a
semi-quantitative PCR technique, in which egg samples without transfection were
used as controls in this study.
Confirmation of PmAV genes
insertion to individual larvae was carried out by extracting genomic DNA in
eight tiger shrimp larvae (0.15 ± 0.05 g in weight) randomly taken for the two
trials of transfection. In observing the expression of the PmAV gene in a
challenge test, hepatopancreas of larvae (10 mg) were collected for RNA extraction
(Parenrengi et al. 2009b). Briefly, RNA total was isolated using an isogen kit and
was then continued with cDNA synthesis using the RTG You-Prime First Strand
Beads. The cDNA was used as a DNA template in the PCR
amplification process using PmAV-F primers: 5'- tagtgcatgcatatgggtcatacaatccta -3' and PmAV-R: 5'-
ctgtctcgagctatgtgtcctgctttcaca -3', with a target fragment of 513 bp. The β-actin gene expression
of tiger shrimp was used as a control gene expression (Sriphaijit and Senapin
2007). The amplification process was carried out on the GenAmp AB-7200 PCR
machine with a pre-denaturation of 94°C for 3 min; 35 cycles for (denaturation of
94°C for 30 s, annealing of 58°C for 30 s, and extension of 72°C for 45 s); and the final
extension of 72°C for 3 min. To ensure the success of target DNA fragment
amplification, the PCR results were run at 1.0% agarose gel and visualized
by the Gel Documentation
System. The VC 100 bp Plus DNA Ladder was used as a molecular weight marker.
Juvenile tiger
shrimp production
Larval transgenic tiger
shrimp were kept in a controlled tank in-door system with a density of 150
shimp m-3 to produce juveniles for 1.5 months rearing period. Larvae
were fed with pellet with a dose of 30% of body weight twice a day. To
determine the effect on introduction of the PmAV antiviral gene in shrimp
growth of total
length and body weight measurements and morphological appearance, shrimp larvae
were kept under controlled conditions until juvenile stage (in 47 days old), where non-transgenic tiger
shrimp were used as a control treatment.
Data analysis
The results of cracking, orientation test of
pProAV-PmAV gene construct, expression of antiviral gene in embryos and larvae,
and detection of PmAV antiviral gene in transgenic tiger shrimp larvae were
descriptively presented. The hatching rate and Table 1: Hatching rate, DNA and cDNA
detection in embryos of tiger shrimp transfected by ProAV-PmAV gene construct
|
Trials |
Hatching rate (%) |
Detection*) |
|||
|
Transgenic
shrimp |
Positive control |
Negative control |
DNA |
cDNA |
|
|
1 |
48.0 ± 14.2a |
60.0 ± 3.0a |
66.8 ± 12.1a |
(+) |
(+) |
|
2 |
28.1 ± 6.4a |
26.2 ± 6.9a |
31.2 ± 14.4a |
(+) |
(+) |
Notes: Numbers on the same row and followed
by the same letters show no significant difference (P > 0.05), numbers were written in mean ± SD, *) = analysis was
carried out on 50 transgenic shrimp embryos (pooled sample), (+) = PmAVgene was positively detected
%20277-284_files/image002.jpg)
Fig. 1: Results of cracking, PCR analysis of the pProAV-PmAV gene construct,
and plating of bacterial clones. A =
cracking results of bacterial clones carrying the pProAV-PmAV gene on agarose
gel where positive sign indicates clones carrying insertion gene while negative
sign as clones without insertion, B
= results of ligation orientation test in vectors where positive sign indicates
a presence of band in size of approximately 1.2 kb indicates a correct
direction while negative sign/without band indicates a wrong direction of
ligation, and M indicates DNA marker, and C
= plating of bacterial clones carrying the pProAV-PmAV gene construct
%20277-284_files/image003.jpg)
Fig. 2: Schematic structure map of pProAV-PmAV gene constructs in the
pBlueskript-SK vector
%20277-284_files/image005.jpg)
Fig. 3: Transgene expression of PmAV gene in tiger
shrimp embryos and larvae. Observation of PmAV antiviral gene expression at 12,
18, 24, and 30 hours post transfection (hpt); the expression of PmAV antiviral
gene (A) and shrimp β-actin
gene as an internal control (B)
survival rate of tiger shrimp
larvae challenged with WSSV were analyzed by variance (ANOVA) and the total
weight and length of tiger shrimp in age of 1.5 months were analyzed by t-test
using Statistix Version 3.0 at 5% level. The PmAV antiviral gene expression of
hepatopancreas of tiger shrimp larvae challenged by WSSV was descriptively discussed.
Results
Construction
of pProAV-PmAV Gene
The pProAV-PmAV gene
construct was successfully created in pBlueskript-SK vector. Cracking result
showed also evidence to insertion of ProAV promoter and PmAV antiviral gene by
comparing to control of blue colony bacteria (Fig. 1A). A confirmation of
orientation test also showed insertion of genes in the right direction (Fig. 1B).
Positive clones carrying the ProAV-PmAV construct were then plated on the agar
medium (Fig. 1C) as material to be used in further work. Fig. 1 indicated that
the ProAV promoter (365 bp) and the PmAV antiviral gene (800 bp) was successful
inserted into up-stream of Poly-A the pBlueskript-SK vector. The illustration
of the gene construct with the sequential component of pProAV-PmAV in vector
was predicted approximately 4.4 kb in length. A map of the pProAV-PmAV gene
construct was presented in Fig. 2.
Transfection
of pProAV-PmAV construct
%20277-284_files/image007.png)
Fig. 4: Cumulative survival rate of
tiger shrimp larvae challenged with WSSV. The observation time of 0 hpt (1), 6 hpt (2), 12 hpt (3), 24 hpt (4), 48 hpt (5), 72 hpt (6), 96 hpt (7), and 120 hpt (9)
%20277-284_files/image009.png)
Fig. 5: Survival rate of tiger shrimp
larvae at after 5 days of challenged test (Number followed by the same letter
indicated no significant difference (P
> 0.05) and bar = standard deviation)
%20277-284_files/image011.png)
Fig. 6: PmAV antivirus gene expression
in hepatopancreas of tiger shrimp challenged with WSSV. Expression in
transgenic (A), non-transgenic
shrimp (B), and β-actin target
genes as internal controls in transgenic (C)
and non-transgenic shrimp (D).
Observation of PmAV gene expression at: (1) initial; (2) 6 hpt; (3) 12 hpt; (4)
24 hpt; (5) 48 hpt; (6) 72 hpt; (7) 96 hpt; and (8) 120 hpt
%20277-284_files/image013.png)
Fig. 7: Morphological appearance of transgenic (A) and non-transgenic (B)
tiger shrimp juveniles at 47 days old
The average hatching rate of
tiger shrimp was no significant difference (P
> 0.05) among treatments for both trials (Table 1). These results implied
that the use of jetPEI reagent and DNA plasmid from the gene construct did not
have a harmful effect on the hatchability of tiger shrimp embryos. The DNA and
cDNA detection showed positively presence the exogenous antiviral genes into
embryos or tiger shrimp larvae (Table 1). In the observation at 12 hpt, the
expression of antiviral gene was started to weakly exhibit until 18 hpt. The
expression of the antiviral gene was strongly expressed as a peaked point at 24
hpt or one day after transfection and the expression fairly dropped at 30 hpt
(Fig. 3).
Survival
and overexpression of larvae
A death of non-transgenic
tiger shrimp larvae began to be significantly exhibited at 12 hpt (day-1) after
the challenge test until 72 hpt (day-3) and after that the shrimp mortality was
not significant (Fig. 4). The survival of transgenic
tiger shrimp larvae was higher than that of normal shrimp larvae when
challenged with WSSV, where at 120 hpt (day-5) showed that the survival of
transgenic tiger shrimp larvae (95.6%) was significantly different (P < 0.05) with non-transgenic tiger
shrimp larvae (positive control) (71.1%), but not significantly different (P > 0.05) from non-transgenic without
challenge test (negative control) (97.8%) (Fig. 5).
After being challenged with
WSSV, PmAV gene for both transgenic shrimp and non-transgenic tiger shrimp
showed up-regulated response by increased induction of antiviral gene
expression (Fig. 6). For transgenic tiger shrimp, PmAV antiviral gene
expression began to be induced since 6 h after exposure and continued to
increase sharply until 96 hpt (day-4) and slightly decreased on 120 hpt (day-5)
after the challenge test. While, non-transgenic tiger shrimp, even also
increased induction until 24 hpt (day-1) and decreased on 48 hpt (day-2) and
then the expression showed relatively lower until the end of experiment.
Growth and morphological
appearance of juvenile
Observation in the 47 days old
showed that the transgenic tiger shrimp did not have morphological differences
in appearance with the non-transgenic (Fig. 7). Transgenic tiger shrimp reached
0.21 ± 0.12 g in body weight and 3.3 ± 0.51 cm in length, while the control
shrimp (non-transgenic shrimp) had a weight of 0.30 ± 0.16 g and a length of
3.5 ± 0.63 cm. Based on the t-test conducted between the two groups of shrimps
showed no significant difference (P >
0.05) both in weight and length. Furthermore, based on a long-term observation
during maintenance, transgenic shrimp appeared to be relatively active, healthy
with normal morphology.
Discussion
The pProAV-PmAV gene
construct was successfully inserted into up-stream of Poly-A the pBlueskript-SK
vector. The number of right ligation direction was relatively lower compared to
the correct ligation direction in the pProAV-EGFP gene construct (86.0%)
conducted by Parenrengi et al.
(2018). The low percentage of ligation in this construction was probably due to
the twice gene ligation performed, firstly insertion with the ProAV promoter
using the BamHI restriction site,
then followed by insertion of the PmAV antiviral gene with SalI restriction site. However, the construction of ProAV-EGFP was
only carried out in one-step of insertion with using the BamHI restriction site. In addition, the quality of competent
bacterial cells used may differ that they influenced the success in obtaining
the correct direction of ligation.
In
application of jetPEI transfectian reagent to the
tiger shrimp, the hatchability in this present study was relatively lower than with
white shrimp
L.
vannamei around 50–60% (Sun et al.
2005). This may be a different quality, species, and spawning technique of
broodstock. However, the use of jePEI and gene construct plasmid did not have a
negative effect to the hatching rate of tiger prawn larvae. The previous
studies also reported that the tranfection of gene construct plasmid did not
show a harmful impact to the embryos (Sheela et al. 1998; Yasawa et al.
2005) Although a
transfection method in L. vannamei showed
a better technique compared to electroporation and microinjection, in terms of
egg hatchability produced (Sun et al.
2005), the microinjection in medaka fish Oryzias
latipes offered a fairly high hatching rate of 70% (Winkler et al. 1991), in catfish Clarias spp. reaching 55.0–93.3%
(Ath-Thar 2007), and in sea bream Pagrus
major around 53–63% (Kato et al.
2007).
Antiviral gene expression in
tiger shrimp embryos/larvae (Fig. 3) showed a closely similarity pattern with
expression of EGFP gene in tiger shrimp embryo/larvae (Parenrengi et al. 2018). This indicated that the
expression of transgene began to decrease after the eggs hatched into naupli.
Based on several studies, foreign gene expression generally started after the
mid-blastula phase and its level increased during embryogenesis stage, and then
decreased after hatching (Alimuddin 2003).
The present study exhibited
the expression on the larvae of transgenic tiger shrimp. Increasement of
transient expression occurred during the process of extrachromosomal replication
of foreign DNA, and subsequently the level of expression decreased due to
degradation of exchromosomal foreign DNA. Transient expression of the hrGFP
gene which was controlled by the β-actin promoter of medaka fish in
catfish Clarias spp. was started to
exhibit, even still very weak, at 4 h after microinjection, and then the
expression increased at 8th and 12th h and thereafter
until 24th h, a sign of decreased expression occurred and finally
undetected (Ath-thar 2007). By using the same promoter, GFP expression in carp Cyprinus carpio showed a similar pattern
to catfish, where the highest expression level was obtained at 12 to 18 h after
microinjection and then after hatching the expression begun to decline until it
was not visible in 1-day old larvae (Purwanti 2007).
The insertion of the PmAV
antiviral gene into tiger shrimp embryos or larvae was a major indicator of the
success of gene transfer. Genomic DNA analysis in the present study showed that
the percentage of tiger shrimp carrying the exogenous PmAV gene was 37.5–75.0%.
The efficiency of transfer of foreign genes to embryos is influenced by the
different transfer method and species. Some researchers reported their success
in introducing foreign genes into crustacean embryos. The rate of gene introduction
in shrimp Marsupenaeus japonicus was
relatively low at 1% only for the microinjection and 0.42% for the
particle-bombardment method. Use of electroporation technique, Arenal et al. (2008) reported that the
transfection efficiency to the white shrimp
L. schmitti embryo was up to 36%. The high efficiency (72%) of TSV-CP gene
introduction has been reported by Sun et al. (2005) in shrimp L. vannamei using the transfection
method. Furthermore, by electroporation method, Tseng et al. (2000) have
proven that bacterial alkaline phosphatase (BAP) gene transfer was integrated
in the tiger shrimp genome, in rate of 31%. The integration of introduced gene
into Indian carp Labeo rohita has
been reported by Rajesh and Majumdar (2005) using the southern hybridization
method. These several successes showed that the transfer of foreign genes to
shrimp embryos is no longer a main obstacle in the development of transgenic
shrimp production.
The result of WSSV challenge
test on tiger shrimp larvae was obviously revealed that the immune response, in
term of survival rate, of transgenic shrimp was higher than that of
non-transgenic shrimp larvae. Shrimp mortality was indicated by change in feed
response decrease, unstable swimming activity, always at the bottom and the appearance
of reddish body colour, as well as white spots on the carapace. A similar
symptom of pathological changes was also reported by Alifuddin et al. (2003) in the study of WSSV
transmission in tiger shrimp larvae. Furthermore, it was noted that the characteristic
of cellular changes by WSSV virus infection in tiger shrimp was the
inflammation of the cell nucleus (hypertrophy) due to the development and
accumulation of virions by developing in the cell nucleus, moving sideways,
then karyolitic occurs to eventually lysis cells. The damage cell contributes
to the cause of the death of tiger shrimp.
Alifuddin et al. (2003) reported that an average survival rate by exposure with WSSV in tiger shrimp larvae was 73.3–91.7%, compared to all survive of larvae without challenged test. The present study indicated survival rate enhancement by 24.5% higher than non-transgenic shrimp. This implied that overexpression of the PmAV antiviral gene played an important factor to increase tiger shrimp resistance to WSSV. Increased resistance of shrimp L. vannamei through TSV-CP gene transfer has been reported by Lu and Sun (2005), where transgenic shrimp larvae had a higher resistance with 83% survival compared to control shrimp of only 44% when challenged with TSV.
Comparing with the
conventional fish immunization, some advantages have been claimed for immunity
enhancement using transgene technology. Fish can be protected from the larval
development, before the immune system started to mature immunity (Dunham 2009).
Gene encoding antimicrobial peptides such as cecropin regulated by CMV promoter
increased the resistance to bacterial disease in channel
fish Ictalurus punctatus up to 2–4
times (Dunham et al. 2002).
Transgenic catfish that carry preprocecropin gene construct showed very high
survival (100%) when exposed to bacterium
Plavobacterium columnare compared to control fish which was only 27.3%.
Meanwhile, when challenged with bacterium
Edwardsiella ictaluri, transgenic catfish also showed high survival (40.7%)
compared to non-transgenic fish (14.8%). Sarmasik et al. (2002) reported that the second generation of transgenic
medaka fish showed high resistance to Pseudomonas
fluorescens with a mortality rate of 0–10% compared to control 40%, and
when challenged with Vibrio anguillarum,
transgenic medaka fish were still able to survive 70–90% while the control was
only around 60%.
The highest increased
expression on day-4 of this present study was agreed with previous research on
the C-type lectin gene on white shrimp L.
vannamei (Luo et al. 2007). Luo et al. (2007) also reported the
naturally occurring expression of the PmAV antiviral gene in non-transgenic
shrimps when challenged with WSSV, where hepatopancreas had the greatest
antiviral gene expression, 700 times higher than in the muscle. Furthermore,
the expression pattern of the PmAV antiviral gene was equivalent to the WSSV
virus load in the body of tiger shrimp. When white shrimp L. vannamei challenged with WSSV, the C-type lectin gene expression
initially decreased on day 2, but thereafter increased sharply until it peaked
on day-4 (Ma et al. 2007). Somboonwiwat et al. (2006) reported an increasement
of gene expression level of interferon-related developmental regulator-1,
glucose transporter-1, lysozyme, profiline, and serpine -B3 in P. monodon haemocyte after exposed to
pathogens, and that these genes had as up-regulated gene expression. When
challenged with pathogens, the penaeidin antibacterial gene showed a strong
expression in shrimp L. vannamei
(Destoumieux et al. 2000) and Fenneropenaues
chinensis (Kang et
al. 2007). The expression of the Rab GTPase gene in shrimp P. japonicus was induced when challenged
with the WSSV (Wu and Zhang 2007), and lysozyme genes in L. vannamei when injected with Vibrio
campellii (Burge et al. 2007).
Related to this finding of
tiger shrimp juvenile observation, Lu and Sun (2005) reported on 236 days old
of transgenic white shrimp did not show morphological differences with
non-transgenic white shrimp, in term of weight 7.67 g and 9.17 g, respectively.
Indeed, Lu and Sun (2005) stated that the decrease in weight gain was probably
caused by the integration of target genes introduced into specific areas of the
genome, which slightly influenced on the initial growth of white shrimp larvae.
This present study implied
that the results of PmAV antiviral gene expression analysis in embryos and
larvae showed strong evidence to the success in transferring the pProAV-PmAV
gene construct into the tiger shrimp. Meanwhile, observing the survival rate
and antiviral genes expression of tiger shrimp when challenged with WSSV
provided a general description of the involvement of the PmAV antiviral gene in
enhancing the immune system of tiger shrimp.
Conclusion
The pProAV-PmAV gene has been
successfully constructed and introduced to the tiger shrimp embryo through a
transfection method. The overexpression of PmAV antiviral gene could enhance
the resistance to WSSV infection and did not have a negative affect to the growth and
morphological appearance of tiger shrimp. This work may
demonstrate an important implication for commercial tiger shrimp aquaculture.
Acknowledgements
We are grateful to
the Ministry of Marine Affairs and Fisheries, Republic of Indonesia for funding
this study through the DIPA of Research Institute for Brackishwater Aquaculture
and Fisheries Extension (RIBAFE). We also thank to researchers and technicians
at Biotechnology Laboratory of Research Institute for RIBAFE, technicians of
Animal Aquatic Laboratory of IPB University and to all those who gave
assistance to support this present study.
Author Contributions
AP
and AT planned the research, performed the
experiment/data analysis, drafted the manuscript and made illustrations; AA and SS supervised
the work, aided in interpreting the results and revised manuscript; All authors provided critical feedback and helped shape
the research.
References
Alifuddin
M, D Dana, M Eidman, MB Malole, FH Pasaribu (2003). White spot disease in black
tiger shrimp (Penaeus monodon Fab.):
transmission through immersion with white spot viruses 20, 100, and 200 µg/mL
with an exposure time of 120 min. J Akuakult
Indones 2:31‒35
Alimuddin (2003). Introduction and expression of foreign
∆6-desaturase-like gene in a teleostean fish. Thesis. Tokyo
University of Fisheries, Japan
Alzaid A, JH Kim, RH Devlin, SAM Martin, DJ Macqueen (2018). Growth
hormone transgenesis in coho salmon disrupts muscle immune function impacting
cross-talk with growth systems. J Exp
Biol 221:1‒10
Anderson ED, DV Mourich, SC Fahrenkrug, S LaPatra, J Shepherd, JA Leong
(1996). Genetic immunization of rainbout trout (Oncorhynchus mykiss)
against infectious hematopoietic necrosis virus. Mol Mar Biol Biotechnol
5:114‒122
Arenal A, R Pimentel, E Pimentel, L Martin, D Santiesteban, R Franco, P
Alestro (2008). Growth enhancement of shrimp (Litopenaeus schmitti)
after transfer of tilapia growth hormone gene. Biotechnol Lett
30:845–851
Ath-Thar
MHF (2007). Effectiveness of β-actin promoter of medaka fish Oryzias latipes with a marker of the
hrGFP (humanized Renilla reniformis
green fluorescent protein) gene in catfish Clarias
spp. Descendants of F0. Thesis. Ministry of Aquaculture, Faculty of
Fisheries and Marine Sciences, Bogor Agricultural University
Austin B, D Allen-Austin (1985). A review: bacterial pathogens of fish.
J Appl
Microbiol 58:483‒506
Bevins CL, M Zasloff (1990). Peptides from frog skin. Annu Rev Biochem 59:395‒414
Burge EJ, DJ Madigan, LE Burnett, KG Burnett (2007). Lysozyme gene
expression by hemocytes of Pacific white shrimp Litopenaeus vannamei, after injection with Vibrio. Fish Shellf Immunol 22:327‒339
Chiou PP, MJ Chen, CM Lin, J Khoo, J Larson, R
Holt, JA Leong, G Thorgarrd, TT Chen (2014). Production of homozygous
transgenic rainbow trout with enhanced disease resistance. Mar Biotechnol 16:299–308
Destoumieux D, M Munoz, C Cosseau, Rodriguez, P Bulet, M Comps, E
Bachere (2000). Penaeidins, antimicrobial peptide with chitin-binding activity,
are produced and stored in shrimp granulocyte and released after microbial
challenge. J Cell Sci 113:461‒469
Destoumieux D, P Bulet, D Loew, AV Dorsselaer, J Rodriguez, E Bachere
(1997). Penaeidins, a new family of antimicrobial peptide isolated from the
shrimp Penaeus vannmaei (Decapoda). J Biol Chem 272:28398‒28496
Dunham RA (2009). Transgenic fish resistant to infectious diseases,
their risk and prevention of escape into the environment and future candidate
genes for diseases transgene manipulation. Compar Immunol Microbiol
Infect Dis 32:139‒161
Dunham RA, G Warr, A Nichols, PL Duncan, B Argue, D Middleton, Z Liu
(2002). Enhanced bacterial diseases resistance of transgenic channel catfish Ictalurus punctatus possessing cecropin
genes. Mar
Biotechnol 4:338‒344
Escobedo-Bonilla CM (2011). Application of RNA
interference (RNAi) against viral infections in shrimp: a review. J Antivir Antiretrovir 2011;
Article S9
Hoffmann JA, JM Reichhart, C Hetru (1996). Innate immunity in higher
insects. Curr Opin
Immunol 8:8‒13
Kang CJ, JF Xue, N Liu, XF Xhao, JX Wang (2007). Characterization and
expression of a new subfamily member of penaeidin anti-microbial peptides
(penaeidin 5) from Fenneropenaeus chinensis. Mol Immunol 44:1535‒1543
Kato K, M Takagi, Y Tamaru, SI Akiyama, T Konishi, O Murata, H Kumai
(2007). Construction of an expression vector containing a β-actin promoter
region for gene transfer by microinjection in red sea bream Pagrus major. Fish Sci 73:440‒445
Lehrer RI, AK Lichtenstein, T Ganz (1993). Defensins: Antimicrobial and
cytotoxic peptides of mammalian cells. Annu Rev Immunol 11:105‒128
Linacero RJ, Rueda, AM Vazquez (1998). Quantification of DNA. In: Molecular
Tools for Screening Biodiversity: Plants and Animals, pp:1‒21.
Karp AP, G Isaac, DS Ingram (Eds.). Chapman and Hall. London, Weinheim, New
York, Tokyo, Melbourne, Madras
Lu Y, PS Sun (2005). Viral resistant in shrimp that express an
antisense Taura syndrome virus coat protein gene. Antivir Res 67:141‒146
Luo T, L Fang, L Kaiyu, X Xu (2007). Genomic organization, promoter
characterization, and expression profiles of an antiviral gene PmAV from the shrimp Penaeus monodon. Mol Immunol
44:1516‒1523
Ma TH, SHK Tiu, JG He, SM Chan (2007). Molecular cloning of a C-type
lectin (LvLT) from the shrimp Litopenaeus vannamei; Early gene
down-regulation after WSSV infection. Fish Shellf
Immunol 23:430‒437
McClelland EK, MTT Chan, X Lin, Sakhrani, FD Vincelli, JH Kim, DD Heath,
RH Devlin (2020). Loci associated with variation in gene expression and growth in
juvenile salmon are influenced by the presence of a growth hormone transgene. BMC Genomics 21; Article 185
Parenrengi A, R Syah, A Tenriulo (2018). Analysis of promoter activity on tiger shrimp
Penaeus monodon using EGFP (enhanced green fluorescent protein) as a
marker gene. Aquacult Aquar
Conserv Legislat 11:1937‒1946
Parenrengi A, A Alimuddin, S Sukenda, K Sumantadinata, M Yamin, A
Tenriulo (2009a). Cloning of ProAV promoter isolated from tiger prawn
Penaeus monodon. Indones Aquacult
J 4:1‒7
Parenrengi A, S Alimuddin, K Sumantadinata, A Tenriulo (2009b). Characteristic of cDNA sequence encoding antivirus gene from tiger
shrimp, Penaeus monodon. J Riset Akuakult 4:1‒13
Purwanti LI
(2007). Test of β-actin promoter activity of medaka fish (Oryzias latipes) in carp (Cyprinus carpio). Thesis. Faculty of Fisheries and Marine Sciences, Bogor
Agricultural University, Java, Indonesia
Rajesh R, KC Majumdar (2005). Transgene integration – an analysis in
autotrangenic Labeo rohita Hamilto (Pisces: Cyprinidae). Fish Physiol Biochem
31:281‒287
Sarmasik A, G Warr, TT Chen (2002). Production of transgenic medaka with
increased resistance to bacterial pathogen. Mar
Biotechnol 4:310‒322
Sheela SG, JD Chen, S Mathavan, TJ Pandian
(1998). Construction, electroporatic transfer and expression of ZpßypGH and
ZpßrtGH in zebrafish. J Biosci 23:565-576
Somboonwiwat K, P Supungul, V Rimphanitchayakit, T Aoki, I Hirono, A
Tassanakajon (2006). Differentially expressed genes in hemocytes of Vibrio
harveyi-challenged shrimp Penaeus monodon. J Biochem Mol Biol 39:26‒36
Sriphaijit T, S Senapin (2007). High expression of a novel leucine-rich
repeat protein in hemocyte and lymphoid organ of the black tiger shrimp Penaeus monodon. Fish Shellf Immunol
22:264‒271
Steiner H, D Hultmark, A Engstrom, H Bennich, HG Boman (1981). Sequence
and specificity of two antibacterial proteins involved in insect immunity. Nature 292:246‒258
Sun PS, NC Venzon, FRO Calderon, DM Esaki (2005). Evaluation of methods
for DNA delivery into shrimp zygotes of Penaeus (Litopenaeus) vannamei.
Aquaculture 243:19‒26
Traxler GS, E Anderson, SE LaPatra, J Richard, B Shewmaker,
G Kurath (1999). Naked DNA vaccination of Atlantic salmon Salmo salar
against IHNV. Dis Aquat Organ 38:183‒190
Tseng FS, HJ Tsai, IC Liao, YL Song (2000).
Introducing foreign DNA into tiger shrimp (Penaeus monodon) by
electroporation [abstract]. Theriogenology 54:1421‒1432
Wakchaure R, S
Ganguly, K Qadri, PK Praveen, T Mahajan (2015). Importance of transgenic fish to global aquaculture: A
review. Fish Aquacult J 6:1‒3
Winkler C, JR Vielkind, M Schartl (1991). Transient expression of
foreign DNA during embryonic and larval development of the medaka fish (Oryzias
latipes). Mol Gen Genet
226:129‒140
Wu W, X Zhang (2007). Characterization of a RAB GTPase up regulated in
the shrimp, Penaeus monodon by virus infection. Fish Shellf Immunol 23:438‒445
Yasawa R, K Watanabe, T Koyama, L Ruangapan, A Tassanakajon, I Hirono, T
Aoki (2005). Development of gene transfer technology for black tiger shrimp, Penaeus
monodon. J Exp Zool 303:1104‒1109